How Does The Brain Perceive Essays - Auditory System, Ear, Cochlea

How Does the Brain Perceive How does a human hear? When an object makes a noise, it sends vibrations (better known as sound waves) speeding through the air. These vibrations are then funneled into your ear canal by your outer ear. As the vibrations move into your middle ear, they hit your eardrum and cause it to vibrate as well. This sets off a chain reaction of vibrations. Your eardrum, which is smaller and thinner than the nail on your pinky finger, vibrates the three smallest bones in your body: first, the hammer, then the anvil, and finally, the stirrup. The stirrup passes the vibrations into a coiled tube in the inner ear called the cochlea. The fluid-filled cochlea contains thousands of hair-like nerve endings called cilia. When the stirrup causes the fluid in the cochlea to vibrate, the cilia move. The cilia change the vibrations into messages that are sent to the brain via the auditory nerve. The auditory nerve carries messages from 25,000 receptors in your ear to your brain. Your brain then makes sense of the messages and tells you what sounds you are hearing. While you are sitting in the meadow, you might hear a calm breeze,some bees buzzing around and maybe some birds chirping. The wind rustles through grass and creates sound waves. Your ears collect these sound waves and causes your eardrum to also vibrate. The eardrum the makes your hammer, anvil, and stirrup. The stirrups vibrations move the liquid in your inner ear and the cilia translate those vibrations into something the brain can understand. The brain processes the messages and realizes that you are hearing a calm breeze. The same thing would happen if you heard a bee buzzing around, except the different sound waves that it makes would cause the ear to process a message that would tell the brain that it is hearing a bee. Likewise for the birds, unless of course its a bird you have never heard before, but we will assume you have. Since we have experienced these sensations before, its like the noise comes in, its processed and matched up to see if we have ever heard anything like it before. Its sort of like pulling open a filing cabinet and looking for something. What happens if we have never heard a sound before. Lets say while you were in the meadow and you heard some hideous shrieking noise. You think to yourself, "What's that?" You would probably have to use your other senses to establish exactly what was making the noise, but after that your mind knows what that particular sound represents. Using the filing cabinet analogy again, it would be just like adding another folder. How does our body feel? Our body feels by getting messages from receptors in our skin. But its not the same for all sensations. For touch and pressure, the skin receptors get pressed on the transmit a signal to the medulla and the thalamus, then it goes to the sensory cortex into the parietal lobe of the brain then the brain translates it into a concept that it can understand. By the characteristics in the signal the brain can tell the difference between a feather in our palm to being tackled by a lineman. If the sensation is a heat, or lack there of, is passed directly to the thalamus and then to the reticular formation. My theory on why it does that is that a change in outside temperature could change our inner- body temperature, thus unbalancing our homeostasis. But no matter whether its pressure or temperature, if the sensation is painful our body reacts completely differently. If there is an instance of pain the brain tells the body to do something to stop it, fast. While we are laying in the meadow on a mid-June day our skin senses are very busy. Since it is sunny and in June, I am assuming that it is warm if not hot. Our skin feels the suns rays burning our delicate skin. It picks up a warmer feeling than when we were in our car with the AC on. It sends a signal to the brain, via the thalamus to the reticular formation, that it warm

How to Test for Protein in Food

How to Test for Protein in Food Protein is an essential nutrient that builds muscle in the body. Its also easy to test for. Heres how: Protein Test Materials Calcium oxide (sold as quicklime in building supply stores)Red litmus paper (or another method to test pH)Â  WaterCandle, burner, or another heat sourceEye-dropperTest tubeMilk or other foods to test Procedure Because milk contains casein and other proteins, its a good food to start your testing with. Once you understand what to expect from testing milk, you can examine other foods. Add a small amount of calcium oxide and five drops of milk to a test tube.Add three drops of water.Dampen the litmus paper with water. Water has a neutral pH, so it should not change the color of the paper. If the paper does change color, start again using distilled water rather than tap water.Carefully heat the test tube over a flame. Hold the damp litmus paper over the mouth of the test tube and observe any color change.If protein is present in a food, the litmus paper will change color from red to blue. Also, smell the test tube: If protein is present, you should be able to detect the odor of ammonia. Both of these indicate a positive test for protein. If protein is not present in the test sample (or is in insufficient concentration to produce adequate ammonia during testing), the litmus paper will not turn blue, resulting in a negative test for protein. Notes About the Protein Test Calcium oxide reacts with protein to break it down into ammonia. The ammonia changes the acidity of the sample, causing a pH change. If your food is already very alkaline, you wont be able to use this test to detect protein. Test the pH of food to see if it changes the litmus paper prior to performing the protein test.Milk is an easy food to test because its a liquid. To test solids, such as meat, cheese, or vegetables, you must first grind the food by hand or by using a blender. You may need to mix the food with some water to make a sample you can test.The test registers a change in pH, which is the concentration of hydrogen ions in an aqueous or water-based solution. Most foods contain water, so they work fine for the test. However, oily foods may not work as well. You cant test pure vegetable oil, for example, because it doesnt contain any water. If you test greasy foods, such as french fries or potato chips, youll need to mash them up and mix them with a bit of water first.

Discussion Essay Example | Topics and Well Written Essays - 250 words - 61

Discussion - Essay Example Trying to match the racial and ethnic structure of the population may not be the best move as it becomes difficult for people to choose where they need to be assigned (Fried and Fottler 37). Furthermore, the medical schools present need to provide the exact number of anticipated nurses targeted to graduate. This is so as to try and fill the number of spots that retired nurses, physicians, and professionals leave after serving in the health field. This can be done through the training-output estimation program, which may bring focus to the projected number of future nurses in healthcare organizations. Predicting the estimated population may present organizations with a foreseeable number of nurses that may be needed in different areas. Ensuring that organizations are aware of these numbers may provide them with a rough estimate of how many nurses, physicians, and professionals may be needed to cater to the rising population (Fried and Fottler 32). These are some of the ways in which the shortages that are occurring nation-wide can be handled and assist in providing prospective nurses the opportunity to work and prove their worth in the health

Court system Essay Example | Topics and Well Written Essays - 500 words

Court system - Essay Example According to the article, it is even possible for Casey to be set free if Judge Belvin Perry rules that Casey could serve the years concurrently. The article also gave a brief background on the details of the trial. It also discussed the varied reactions on the verdict from the people inside and outside the courtroom. I think that the writers of the article presented the facts of the case in a fair and unbiased manner. They gave both sides of the case in an objective manner. However, there was one part of the article where I doubted their being fair, specifically in page 2. The title given to that part of the article is â€Å"Casey Anthony’s Shocking Verdict† (Hopper, Friedman and De Nies 2). I think that the word â€Å"shocking† implied that the authors expected a guilty verdict. I myself am not in agreement with the â€Å"not guilty† verdict given by the jury. I felt that there was enough evidence to convict Casey for the gruesome murder of her daughter. The question left unanswered by the article is whether an appeal could still be made by the prosecutors.

Theories of juvenile deliquency Assignment Example | Topics and Well Written Essays - 250 words

Theories of juvenile deliquency - Assignment Example In order to belong, youths have the ideology that they have to be rich and famous. Economically underprivileged adolescents may be pressured to obtain money in unlawful ways, such as stealing and the like. The thinking of the youth today must be transformed and they should be made aware that they have to be critical in choosing their peers. Another theory is that of Albert Bandura. His theory is known as the â€Å"Social Learning Theory†. Bandura points to the environment as the cause of possible criminal acts committed by the youth. He reasoned that the adolescent observes his environment and tries to imitate what he sees. In this specific theory, family, peers, and media can directly influence the behavior of the youth (Kartha, 2010). The picture on the right suggests the effect of media on today’s youth. Juveniles are usually in want of entertainment and their common sources of this are the television and the internet. Viewing shows that can either directly or indire ctly promote violence can affect the mind of the viewing minor. Without authoritative parental guidance, he might be led to thinking that what he views is acceptable by society. To reduce cases of juvenile delinquency, parents are compelled to monitor the shows and websites their children see.

Genetic Variation of Taste Receptors

Genetic Variation of Taste Receptors Abstract: The people have different behaviour to choose the food, and there are many factors that affect the food choices. The best significant factor to choose the food is taste. Differences in taste perception of several taste modalities are associated to difference in the taste receptors. Polymorphisms of the genes that encoding these taste receptors may clarify these unpredictability in taste perception. Individual changes in the capability to identify bitter tasting compounds, such as phenylthiocarbamide (PTC) was a well-known example of this variability. This difference divided the people in two groups: tasters and non-tasters, and is because of in part to single nucleotide polymorphisms (SNP) of a bitter taste receptor gene, taste receptor, type 2 (TAS2R) 38. The experiment was designed to determine the PTC phenotype and genotype, the SNP at position 785 is of particular importance in genotyping. DNA was extracted from check cell by using Chelex technique and genotyped by using polymera se chain reaction (PCR) followed by restriction fragments length polymorphism (PCR-RFLP). A 2% of Agarose gel electrophoresed and stained with Ethidium Bromide to imagine the genotype pattern. The class was tasted PTC test paper to compare phenotype and genotype. The total was 108 students the genotype showed 21 taster (+/+), 51 was mild taster (+/-) and 36 was nontaster (-/-). The allele frequency was not statistically significantly differ from European population. Therefore, TAS2R38 genotype is a truer estimation of the extent of the influence of this single gene on taste perception of PTC in a genetically diverse population. Introduction: Taste perception is the most sensitive predictor of how much a food is pleasant and unpleasant. The people are different in the taste perception of sweet, bitter, sour, or salty tastes which could influence the dietary behaviour (2, 3, 4). The variations in the taste perception between the individuals may relate to a variation in the gene taste receptors (2). The gene family of the taste receptors are encoding from TAS1R and TAS2R. The bitter taste receptors are include the TAS2R38 and TAS2R550. While the umami and sweet taste receptors is the TAS1R. The sour taste receptors are the PKDIL3 and PKD2L1. The genetic variation in these receptors may causes to deferential favourites for some types of food. Phenylthiocarbamide (PTC) compounds is the example was more studied in the variation of the sensitivity of taste as the bitterness (2, 5). The TAS2R38 gene is one of the most studied from over twenty-five in bitter taste receptor gene (4).The TAS2R38 gene is responsible for the taste perception of PTC as more bitter and the other related compounds like 6-n-propylthiouracil (PROP) which both contain a group of thiourea (7.8). The variation in the gene TAS2R38 divided the individuals in two groups of thiourea tasters: tasters and non-tasters (4, 5). Phenylthiocarbamide (PTC) The variation in the taste perception of PTC rely on the genetic studies. In 1930s, difference in the ability to taste PTC was first finding by Arthur L. Fox in a laboratory accidental (6). When he was working in the laboratory and transferring PTC powder into a bottle. Some particles of PTC powder flew into the air and his colleague close to him C. R. Noller tasted the particles as bitter but Fox tasted nothing. Fox was make experiment to test a large number of individuals and he found the difference in their ability to taste PTC and he divided the people in two main groups’ tasters and non-tasters (1). Worldwide about 25% of population classified as ‘non-tasters’ and the remaining 75% as ‘tasters’ (1). In addition, Bartoshuk et al, in 1992, discovered that the ‘tasters’ varied in the perception of PTC/PROP in a bi-modal fashion, and they separated them into medium tasters and supertasters. The supertasters were very sensitive to PTC, pe rceiving them as more bitter, while the medium tasters may taste PTC and found it mild bitter. Besides, the spread of super, medium and non-tasters in the general population is roughly 25%, 50% and 25%, respectively (1). The PTC sensitivity believed to be inherited as a simple Mendelian trait with two alleles a dominant trait (T) for taster and recessive trait (t) for non-taster (9). Figure 1: shows the inheritance of PTC trait. PTC genotype TAS2R38 or PTC gene is located on chromosome 7q and consists of a single coding exon 1002 bp long, encoding 333 amino acids, 7-transmembrane domain G-protein-coupled receptor (2, 6). A number of SNPs have been identified within this gene, the three most common SNPs (>1% of the population has variants at a specific DNA sequence, considered an SNP and (4).Also, the PAV/PAV homozygotes are sensitive to PTC more than PAV/AVI heterozygotes while AVI/AVI homozygotes are fewer sensitive (4). The AVI haplotypes in the non-tester differ at 3 SNPs from the PAV haplotypes of the tasters (9). The aim of this practical: To focus on the TAS2R38 genotype and its link with the ability to taste PTC test paper. The SNP at position 785 is of specific concern in genotyping. Comparing the allele frequency detected in the class with those observed in European population subject in group 226 and Sub-Saharan African subject in group 224. Material and Methods: To determine the TAS2R38 (A262V) genotype by using the polymerase chain reaction (PCR) and restriction endonuclease digestion, Fnu4H1 enzyme. The procedure that has been done was as the following: Protocol of DNA Extraction from Cheek Cell (scrape or wash): First week take a 10 ml of water pour into mouth and swirl to release buccal cells and spit back contents into tube. Centrifuge the tube at 3000rpm for 3 minutes, carefully pour off supernatant and retain cell pellet. Added 350Â µl of 5% Chelex mix and then transfer the pelleted buccal cells to new (1.5ml) Eppendorf tube. The 5% Chelex to protects DNA breakdown under a high temperature. Added 4Â µl of proteinase K to the Eppendorf tube that contains buccal cells and 5% Chelex. Incubated the tube containing chelex/cells at 56Â °C for 30 minutes in the heating block, then briefly vortex the tube for 10 seconds after that centrifuge the tube at 3000rpm for 20 seconds. Incubated the tube ( chelex/cells) again in heating block at 98Â °C for 15 minutes, then vortex the tube for 10 seconds, after that centrifuge for 3minutes.Transferred the supernatant that above the chelex containing the buccal cell (DNA template) into the sterile 1.5ml Eppendorf tube and measured the DNA concentration by take 1Â µl of DNA into machine called nanodrop nucleic acid then kept at -20Â °C to preserve the DNA. Protocol of Phenyl Thiocarbanate(PTC) using PCR Reaction: Second week take a 43.5Â µl of master mix was already prepared in the PCR tube and transferred 6.5Â µl of DNA extraction. (Buccal cell DNA).Vortex and spin the tube to make the liquid contents to bottom of the tube. The total PCR tube reaction volume contain 50Â µl of mixtures were placed in the PCR machine and the thermal cycler conditions were: cycle of 94Â °C for 4 minutes. The 40 cycles of 55Â °C for 40 seconds, 72Â °C for 40 seconds and 94Â °C for 40 seconds .Then 1 cycle of 55Â °C for 5 minutes and at 72Â °C for 5 minutes. The sequence of Forward primer was 5’ AACTGGCAGAATAAAGATCTCAATTTAT3’ The sequence of the Reverse primer was 5’ AACACAAACCATCACCCCTATTTT 3’. Restriction Digestion (Fnu4HI): Last week transferred a 20 ÃŽ ¼l of the component mixture (PCR product) to a tube containing 10ÃŽ ¼l of the restriction endonuclease master. The tube was placed in into a 37Â °C heating block for two hours. Electrophoresis of PCR Products: A 30ml of 2% Agarose gel with 0.5Â µl/ml of ethidium bromide was loaded into the gel tank with adjusting the comb, the gel was kept 15 minutes to get stuck. After that the TBE buffer was loaded, covering the surface of the gel and the comb was removed. Take 12Â µl of PCR product undigested and digested into two different tubes added 3Â µl of DNA loading buffer mix and spin. Then, 10ÃŽ ¼l of PCR product/loading buffer was loaded into the well of 2% Agarose gel and 10ÃŽ ¼l of the ladder (100bp) was added in the last well. The gel electrophoresed at 90 volt for 45minutes, negatively charged (-ve) DNA moved toward the anode side (red). Last take gel photograph under UV trans-illumination. Taste tests: The PTC taste test paper was used to observe the capability to identify the bitterness of PTC and its relative with the TAS2R38 genotype. Statistical analysis: The data of the allele frequency for C785 and T785 observed in the class was compared to the allele frequency of European population subjects in group 226 and Sub-Saharan African subject in group 224 by using the Chi square test. The Chi square test was also used to investigate the association between the TAS2R38 genotype and phenotype. All statistical analyses were performed with Minitab data analysis software. References Feeney E. The impact of bitter perception and genotypic variation of TAS2R38 on food choice. Nutrition Bulletin. 2011; 36(1):20-33. Wooding S, Kim U, Bamshad M, Larsen J, Jorde L, Drayna D. Natural Selection and Molecular Evolution in PTC, a Bitter-Taste Receptor Gene. The American Journal of Human Genetics. 2004; 74(4):637-646. Chaudhari N, Roper S. The cell biology of taste. The Journal of Cell Biology. 2010; 191(2):429-429. Feeney E, OBrien S, Scannell A, Markey A, Gibney E. Genetic variation in taste perception: does it have a role in healthy eating? Proc Nutr Soc. 2010; 70(01):135-143. Lalueza-Fox C, Gigli E, de la Rasilla M, Fortea J, Rosas A. Bitter taste perception in Neanderthals through the analysis of the TAS2R38 gene. Biology Letters. 2009; 5(6):809-811. Kim U, Drayna D. Genetics of individual differences in bitter taste perception: lessons from the PTC gene. Clinical Genetics. 2004; 67(4):275-280. Dotson C, Shaw H, Mitchell B, Munger S, Steinle N. Variation in the gene TAS2R38 is associated with the eating behavior disinhibition in Old Order Amish women. Appetite. 2010; 54(1):93-99. Duffy V, Davidson A, Kidd J, Kidd K, Speed W, Pakstis A et al. Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake. Alcoholism: Clinical Experimental Research. 2004; 28(11):1629-1637. Merritt R, Bierwert L, Slatko B, Weiner M, Ingram J, Sciarra K et al. Tasting Phenylthiocarbamide (PTC): A New Integrative Genetics Lab with an Old Flavor. The American Biology Teacher. 2008; 70(5):e23-e28. Appendix

Terry Tempest Williams’ Refuge Essay -- Terry Williams Refuge Essays

Terry Tempest Williams’ Refuge Adaptation is the source and story of a species’ survival. Human beings’ journey across and habitation of the earth’s surfaces demanded resilience to change. As a result each race is a product of the land in which they inhabited. We have grown with the land. Our physical traits tie us to a particular region, a particular place, but what of our emotions? Are they another link to our homelands or do they orphan us, forcing us to seek refuge? Terry Tempest Williams’ Refuge, is the story of her adaptation to change, her struggle to weather changes. The emotional maturity of her relationship with the Great Salt Lake is a subset of her wider community’s relationship to their homeland. This emotional separation from the land is characteristic of modern societies, not the archaic ones. For a Native American tribe like the Sevier-Fremont, the land is ---. In order to successful adapt to the changes in her life, Williams combines the present day idea of owner ship of the land with the Sevier-Fremont people’s example of reaction to changes in the land to form the skills necessary for her survival. In 1982 the Great Salt Lake had begun to rise once more and Williams’ mother’s cancer had returned. As naturalist-in-residence at the Utah Museum of Natural History, she was interested in the effect this rise in the lake would have on the Bear River Migratory Bird Refuge as well as the measures implemented by the state to control this unprecedented rise. The Great Salt Lake preserved many of Williams’ childhood memories in its briny waters. Its rising waters threatened to destroy everything that had grown from it and depended on its stability. Williams believed that left on its own the lake would right itself. ... ...d and selflessly relinquishes her mother to death. She comes to realize the cycles involved in life and enters a new relationship with her mother and the Great Basin. Her mother although she’s dead is always with her and the Great Basin has now become her home. In an act of civil disobedience Williams goes to protest at a testing site armed with her pen and paper. Wlliams shows her understanding of the natural cycle of death by leaving an injured bird she could have saved to be with her dying mother. Terry Tempest Williams’ Refuge is an illustration of human beings deteriorated relationship with nature. Nature is no longer our life source but something for us to own and control. Although we might recognize its life giving potential we do not see it as part of ourselves in that whether we were molded from its clay or evolved from bacteria. We grew from the earth. Terry Tempest Williams’ Refuge Essay -- Terry Williams Refuge Essays Terry Tempest Williams’ Refuge Adaptation is the source and story of a species’ survival. Human beings’ journey across and habitation of the earth’s surfaces demanded resilience to change. As a result each race is a product of the land in which they inhabited. We have grown with the land. Our physical traits tie us to a particular region, a particular place, but what of our emotions? Are they another link to our homelands or do they orphan us, forcing us to seek refuge? Terry Tempest Williams’ Refuge, is the story of her adaptation to change, her struggle to weather changes. The emotional maturity of her relationship with the Great Salt Lake is a subset of her wider community’s relationship to their homeland. This emotional separation from the land is characteristic of modern societies, not the archaic ones. For a Native American tribe like the Sevier-Fremont, the land is ---. In order to successful adapt to the changes in her life, Williams combines the present day idea of owner ship of the land with the Sevier-Fremont people’s example of reaction to changes in the land to form the skills necessary for her survival. In 1982 the Great Salt Lake had begun to rise once more and Williams’ mother’s cancer had returned. As naturalist-in-residence at the Utah Museum of Natural History, she was interested in the effect this rise in the lake would have on the Bear River Migratory Bird Refuge as well as the measures implemented by the state to control this unprecedented rise. The Great Salt Lake preserved many of Williams’ childhood memories in its briny waters. Its rising waters threatened to destroy everything that had grown from it and depended on its stability. Williams believed that left on its own the lake would right itself. ... ...d and selflessly relinquishes her mother to death. She comes to realize the cycles involved in life and enters a new relationship with her mother and the Great Basin. Her mother although she’s dead is always with her and the Great Basin has now become her home. In an act of civil disobedience Williams goes to protest at a testing site armed with her pen and paper. Wlliams shows her understanding of the natural cycle of death by leaving an injured bird she could have saved to be with her dying mother. Terry Tempest Williams’ Refuge is an illustration of human beings deteriorated relationship with nature. Nature is no longer our life source but something for us to own and control. Although we might recognize its life giving potential we do not see it as part of ourselves in that whether we were molded from its clay or evolved from bacteria. We grew from the earth.