Teenagers and Alcohol - 1584 Words

What do many teens hope to become? Adults; teens want to be seen as respected adults and have the same privileges as adults. One privilege that teens don’t have is to be allowed to drink at the age of eighteen. Before an experienced adult would answer this question of whether or not teens should be allowed to drink, they need to ask themselves – should eighteen-year olds drink? Some people say yes because teenagers are responsible for their actions and should be able to have a little more leniency. Others say no, because teenagers are more likely to get into trouble with alcohol use and possible accidents due to drinking and driving. However a person looks at this argument, teenagers should be able to make their own decisions in life and learn from their mistakes. People generally know that teenagers will find many ways to get alcohol. Teenagers find way to push the law requiring them to be twenty-one to purchase and consume alcohol underground or go around the law to get what they want. Teenagers use alcohol for reasons including stress and depression, a need to rebel, and social pressure. Psychologists, sociologists, and even ordinary citizens often wonder what effects alcohol has on the brain, whether drinking has a significant impact on crime and punishment, and why teenagers drink in the first place. A strong debate exists as to whether the legal drinking age should be lowered from twenty-one to eighteen. Some believe that the lowering of the drinking age would curbShow MoreRelatedStereotypes in Alcohol Advertising to Teenagers3305 Words   |  14 PagesStereotypes in Alcohol Advertising to Teenagers 1. Gender Messages in Alcohol Advertising Stereotypes refer to standardize and simplified conception of groups, based on some prior assumptions. For example, a girl might not choose to be an engineer as most of the people have set their minds that the profession is always a guy. This is what we call stereotyping. But, who says a girl cannot be an engineer? According to the Media/Impact: An Introduction to Mass Media, NinthRead MoreFactors That Influence Teenagers On Alcohol And Effects1570 Words   |  7 PagesFactors that influence Teenagers in alcohol and Effects Introduction The teenage years are the time of searching ourselves, engaging in different activities, doing something to fit to our peers and trying to form what we want to be. They are usually under the pressure on the school activities and performance. Sometimes, pressure from their parents who has big expectations from them is the reason why they engaged alcohol. In the present, numerous teenagers are already engaging alcohol consumption. DespiteRead MoreThe Effects Of Alcohol Increases Risk On Teenagers2375 Words   |  10 PagesIntroduction This project is going to examine whether alcohol increases risk taking behaviours in teenagers, using relevant evidence to support the points made, this will include journal articles, books, peer views, dissertations from the results of my structured search. This writing also looks at government policies and legislation which are in place to ensure health and safety of the public. The project will also include good practice identified in the journal articles or if the practice contributesRead MoreDrug And Alcohol Use Among Teenagers1614 Words   |  7 PagesDrug and alcohol use of persons under the age of 18 is prevalent (National Institute on Drug Abuse [NIDA], 2014). â€Å"Illicit drug use among teenagers remains high, largely due to increasing popularity of marijuana† (NIDA, 2014, pg.2). In 2013, approximately 7% of 8th graders, 18% of 10th graders, and 22% of 12th graders used marijuana in the past month. These rates have increased since the mid to late 2000’s. â⠂¬Å"6.5% of 12th graders now use marijuana every day, compared to 5% in the mid-2000’s† (NIDARead MoreEssay on How Alcohol Effects Teenagers2113 Words   |  9 PagesAlcohol has many effects on the body, especially the teenage body. Alcohol abuse and alcohol dependence are not only adult problems -- they also affect a significant number of adolescents and young adults between the ages of 12 and 20, even though drinking under the age of 21 is illegal (Dimeff 204). Alcohol is created when grains, fruits, or vegetables are fermented. Fermentation is a process that uses yeast or bacteria to change the sugars in the food into alcohol. Fermentation is used toRead MoreCase Study on the Excessive Use of Marijuana and Alcohol in Teenagers613 Words   |  3 PagesCase Study on the Excessive Use of Marijuana and Alcohol in Teenagers Problem Excessive use of marijuana and alcohol, especially within the last 2 years. Kurt began drinking and using marijuana at age 14 and by age 15 referred to the usage as heavy. Despite recently being caught for the theft of his parents TYME card and $400, which resulted in him being forced to join an AODA group, he still continues to use on a regular basis. He has also gone to work while intoxicatedRead MoreDrinking Alcohol Is A Hobby Most Adults And Even Some Teenagers1536 Words   |  7 PagesDrinking alcohol is a hobby most adults and even some teenagers participate in. Alcohol is a poison to the human body. The body only tolerates a certain amount of alcohol at a time, so when people drink too much at once they can become intoxicated and drunk. The excessive use of alcohol can be very dangerous to the body. It can impair your vision, decreases vision, and slows your reaction time. That’s why drinking and driving is one of the leading causes of death in the United States of America.Read MoreTeenage Alcohol Abuse1465 Words   |  6 PagesAlcohol Abuse in Teenagers Underage alcohol abuse is a growing problem in the lives of teenagers today. Almost 80% of high school students have tried alcohol (Dowshen). To effectively combat this growing epidemic, teens need to understand the effects of consuming alcohol, and adults need to recognize the problem and effectively prevent alcohol abuse. Though many teenagers do not realize it, alcohol can significantly affect a teen’s life, including short-term impacts on the teen’s popularity andRead MoreThe Effects Of Alcohol And Teen Drinking1069 Words   |  5 Pages(2), teenage drinking is widespread, and teenagers believe that it is acceptable. But, teenagers’ bodies are still developing. They fail to realize that consuming alcohol places them in danger  for numerous issues.   Consuming alcohol is more widespread among teenagers than most realize. Alcohol and Teen Drinking (1) reports that three-fourths of seniors,  a little over two-thirds of Sophomores, and two out of five 8th graders have experimented with alcohol. With rising statistical information availableRead MoreIs Underage Drinking Not Only Effect Their Live?1650 Words   |  7 PagesActually underage drinking not only effect their live, but also affect teenager’s health. Research has shown that about 40% of teens drinking of 14-19 degree is achieved the level of short-term risk of harm. So what harm does alcohol do to your body? First of all, alcohol can poison the liver, cause the liver function damage. Excessive drinking consumption increased the burden on the liver. Mainly depends on the oxidative decomposition, damaged liver cell degeneration. Eventually lead to cirrhosis

Changes Europe Experienced During The Industrial Revolution

Changes Europe experienced during the Industrial Revolution o The Industrial Revolution of the late eighteenth and middle nineteenth was progressive on the grounds that it modified, revolutionized the productive capacity of England, Europe and United States. In any case, the upheaval was something more than just new machines, smoke-burping processing plants, expanded efficiency and an expanded way of life. It was an upheaval which changed English, European, and American culture down to its extremely roots. Like the Reformation or the French Revolution, no one was left unaffected. Everybody was touched in some way peasant and noble, parent and youngster, artisan and commander of industry. The Industrial Revolution serves as a key to the beginnings of cutting edge Western society. The same number of history specialists has viewed, the Industrial Revolution was no inconsequential progression of changes in cutting edge frameworks and era, and however a social change with social reasons furthermore critical social effects. The Industrial Revolution can be said to have made the European working-class. It made the European middle-class as well. In the wake of the Revolution, new social associations appeared. There is no denying the way that the Industrial Revolution began in England eventually after the focal point of the 18th century. England was the First Industrial Nation. As one money related understudy of history commented in the 1960s, it was England which at firstShow MoreRelatedIndustrial Revolutions During Europe During The Industrial Revolution1298 Words   |  6 PagesIndustrial Revolution in Europe Before the industrial revolution, Europe was mostly dominated by farmers but as the industrial revolution progressed this changed dramatically. Industrial revolution had a significant impact in the process by making new demands that shaped the way of life through increased competition and technological innovation. Generally, it was a historical period that sparked in a stroke a number numerous changes in the economic, social and political dimensions. It is consideredRead MoreThe Industrial Revolution During The 19th Century955 Words   |  4 Pages19th centuries Europe found itself dealing with vast changes in its way of life. The Industrial Revolution took Europeans from the rural countryside into the urban powerhouses as the continent experienced a sudden shift in everyday living, economic structure, and social hierarchy. This sudden change in how Europe was ran from an economic standpoint caused yet another rift between the proletariats and bourgeoisies. Life became difficult for the newly founded working class of Europe as shown in FriedrichRead MoreThe Causes And Effects Of Europe945 Words   |  4 Pagesa constant theme of revolutions and counterrevolutions across space and time that have shaped the very foundations of societies across the expanse of the continent. Furthermore, these revolutions occurred in many different spheres of daily life. For instance, some revolutions featured prolonged periods of violent political upheaval while others featured a more subtle revolution, changing the very social fabric of Europe. In addition, some revolutions centered on economic change while still othersRead More The European Expansion and its Effects on the World Essay1260 Words   |  6 Pagesscientific revolution was fueled by the blending of â€Å"liberal† and â€Å"servile† arts, in other words, science and technology. Because of the European expansion taking place throughout the world, new commerce and industries were advancing, creating the need for new technology and science. The theories and inventions that Copernicus, Galileo, and Newton provided were the fist major advances during the scientific revolution, and perhaps were the most profound. The European expansion during the 15th andRead MoreThe Industrial Revolution Essay742 Words   |  3 PagesThe Industrial Revolution The Industrial Revolution is the name given to the movement in which machines changed peoples way of life as well as their methods of manufacturer. It brought three important changes: inventions of machines that simplify and speed up the work of hand tools, use of steam (and other power) versus human power, adoption of a factory system. Workers were brought together under one roof and were supplied machines. The Industrial Revolution began throughout the worldRead MoreThe Transformation of Europe Essay1252 Words   |  6 PagesOver two-hundred years ago, Europe was a vastly different place. To the modern eye, the Europe of the 18th Century would be unrecognizable compared to its current state. However, the road to this new Europe has been not been all kicks and giggles, but a rather rough and tumble journey. Due to the introduction of new ways of thinking, the occurrences of multiple revolutions, changes in government style and leadership, which led to the creation and extinctio n of numerous countries as well as rearrangementRead MoreThe First Humans Were Hunter Gatherers907 Words   |  4 Pageseconomic and political system. Over time the industrial revolution transformed capitalist nations from agriculture to industrial nations. Throughout history countries have wanted to control lands beyond their borders and a new practice named colonialism give Europeans full or partial political power over countries they occupied, or settled in the â€Å"Age of exploration.† The feudal system is often referred to as Europe Dark Ages or Middle Ages. During the feudal system small communities were formedRead MoreImpact Of Industrialisation On Patterns Of Urban Development1498 Words   |  6 Pagescentury Europe Urbanization is defined as an omnipresent process during which a primary and rural society revolves gradually into a cultivated and industrious one. The linkage between industrialization and urban growth defies an explicit description it is tight and visible, but cannot be simply reduced to direct linearity. It is well known that many small African countries have initiated or accomplished low-level urbanization without economic growth. Roughly without industrial revolution, a few citiesRead MoreThe Economic Expansion Of Venice1738 Words   |  7 Pagesthe size of London. This expansion includes contractual innovations making economic institutions much more inclusive such as commenda. Government documents replaced with new names. The economic expansion of Venice created more pressure for political change. There are some innovation such as Great Council with sub councils Senate and the Council of Forty, General Assembly, new doge had to swear an oath of office. The institutional innov ations included creation of independent magistrates, courts, a courtRead MoreThesis on the First World War1510 Words   |  6 Pagesstep: the change in the context and trend of war in terms of ferocity of the weapons and the increase in human/nations participation was occasioned by the industrial revolution and the French revolution. B. Thesis: The First World War stimulated the greatest changes in warfare because it brought about new technology and industry development, advancement in science, and improved infrastructure and communication; essentially the First World War combined the legacies of the French and Industrial Revolutions

The Short Bus Free Essays

In the summer we got a writing assignment. For this assignment we had to read the book The Short Bus and write a paper about it. Later on after school had started and time had passed the author of the book, Jonathan Mooney came in and had a presentation with us. We will write a custom essay sample on The Short Bus or any similar topic only for you Order Now Now I will be writing about the many different implications, both positive and negative, of being labeled different in our society. Also, I will describe and justify my ethical response to the use of words as weapons against others. Being labeled in our society is not necessarily a bad thing, it could be good. A good thing that comes from this is it helps you understand if someone is mentally handicapped. For an example, if someone has a mental handicap they could be considered â€Å"slow† and that is a nicer thing to say than â€Å"retarded† so to speak. Also, another reason this would be good is because in many schools special services are offered to those who are â€Å"different†. Tutoring, extended times on tests, alternative courses, and even a dedicated classroom can all be offered. But, in order to be qualified for those offerings, you would have to have the label of being mentally handicapped. My thought on this would be that many people that have mental handicaps already know that they are the way they are. They also usually accept the fact that they have a disability that many others do not have. On the other hand, there are unfortunately some bad things in this. Labels can be a very hurtful thing to a lot of individuals. Labels can add to prejudice and discriminations. They could also prevent or discourage you from getting to know someone. Being called gay, retard, or even an idiot are all forms of discrimination. If someone is homosexual or mentally handicapped they can most definitely not help it, it was the way they were born. I’m sure that most people that have these â€Å"problems† so to speak already feel like an outcast and giving people labels just makes the situation a lot worse and more painful. Also, this could very possibly make you not want to get to know someone. If all of your friends are giving a certain someone labels and making fun of them, there is a very good chance you would be discouraged in getting to know this person. That is not fair at all to the person getting the label or the person that would want to get to know someone. Another thing, when you are diagnosed with a handicap the handicap is not permanent. Therefore, you could eventually lose the handicap and still be considered the label in school and still have the special classes and extensions and such. On the other hand, if you never had any handicap before and you develop one sometime in the future, you would not be able to have special tutoring, extended time on tests, alternative courses, and a dedicated classroom, etc†¦ until you were diagnosed with the mental handicap that you could very possibly have obtained in the future. The second part of this essay I will give my ethical response on using words as weapons against others. I do not know where name-calling, labels, or being â€Å"different† originated from, but I despise it greatly. I think name-calling, labels, and all forms of using words to hurt others are very unacceptable. All this does is hurt someone; it does not help the person who is saying the words, at all. A lot of the words people use to hurt others do not even make much sense. For an example when someone says someone is ghetto it that someone or something is trailer trash. No one really knows where this came from and it really does not make sense at all yet, people still use it to hurt others. Using words to hurt people can become a pretty big deal. Recently, a handful of homosexual students committed suicide due to the bullying by others. According to ABC News Clementi jumped off the George Washington Bridge Tuesday, days after his roommate allegedly posted video on the Internet of him having sex with another man. The recent eruption of gay teen suicides has been across the country, from the East Coast to Indiana, Texas to California, where 13-year-old  Seth Walsh, who recently hanged himself,  was memorialized Friday night This could happen to anyone at any time if the verbal bullying does not come to a stop. In this paper, I wrote about the many different implications, both positive and negative, of being labeled different in our society. Also, I described and justified my ethical response to the use of words as weapons against others. I think I gave my opinion pretty clearly. I also gave an example of what bullying others verbally could to do someone, thanks to ABC News. How to cite The Short Bus, Papers

Many people have experienced t... free essay sample

Many people have experienced tough and unimaginable events in their life that have marked them for the rest of their existence. For example, in Maya Angelous biography, we learn that she suffered many traumatic events that would result in her contributions to literature, civil rights, womens rights and the arts. Maya Angelou was born Marguerite Johnson in 1928, in St. Louis, Missouri. At a young age she finds herself and her brother being shipped back and forth from their mothers in St. Louis, to their paternal grandmothers care in Stamps Arkansas, where she has some of her first experiences of segregation(Sauders). According to Poetry for Students, in 1935 her father took Maya Angelou and her brother, back to live with their mother in St. Louis; There Ms Angelou, at the age of seven was raped by her mothers boyfriend. Her assailant was arrested,and he was subsequently released; but justice would be served in the streets where her uncles beat him to death. We will write a custom essay sample on Many people have experienced t or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Maya, however, felt responsible for his death because she had identified the man that raped her. She stopped talking as a consequence, of that terrible tragedy. She and her brother were sent back to Arkansas, where they sought the help of Ms. Flowers the towns teacher, to help Maya out of her muteness. This is where Maya, is first introduced to poetry, and is told that poetry is meant to be read aloud in order to be appreciated. She began speaking as she recited poetry out loud, and this is where she develops her love for poetry. Through poetry Maya Angelou, was able to convey her feelings, life experiences, and was able to inspire other women overcome adversity and stand triumphantly against those who wish to keep them down.Angelous personal struggles are well reflected in her poem Still I Rise, where she expresses her struggles trying to overcome a society full of prejudice and oppression, yet she was still able to rise powerful above all hardships. (Although, Maya Angelou had a hard life growing up, she still managed to prevail above racism and discrimination and became one of the greatest African-American civil rights activist as well as one of the greatest influential womens poets of our times, in her poem Still I Rise she is able to .)Thesis in progress To fully understand the theme of the poem Still I Rise, we can look further into Maya Angelous life. According to Contemporary Black Biography Maya Angelou, was raised during a period when being black in the South meant having to experience discrimination, hatefulness, oppression, and poverty. The topic of racism and slavery date back to centuries ago, a period were people of color experienced unimaginable distress and oppression. Maya Angelou, uses her feelings to convey her thoughts in a time when she felt she was being ruled over. In the first stanza Angelou is directing her writing to those who have oppressed others you may write down in history with your bitter, twisted lies(1). This is referring to the cruelty that slaves endured at the hands of their oppressors. This is a message of hope, strength and the resilience that all human beings have to overcome painful events in their life. This is a clear defiance of peoples inner strength that no matter what happens she will still rise. In the poem Still I Rise Maya Angelou, uses the literary devices such as allusions,similes, symbolism, repetition, and imagery. The tone of the poem is sometimes sarcastic and proud like taunting those who like to put down those who are trying to succeed and rise against all odds. The poem is full of emotions from love to outrage for racial injustice. Firstly, Maya Angelou, uses similes to compare herself to nature relentlessly rises above all struggles You may tread me down in the very dirt meaning [you] want to keep me down her use of the words tread and dirtIn the second stanza Angelous use of similes and imagery .In the first stanza, Angelou writes Does my sassiness upset you? Why are you beset with gloom? Cause I walk like Ive got oil wells Pumping in my living room(2). With this imagery, she is saying that even though she has been discriminated against she is still able to have that inner confidence and no one can take that from her because to her that is her richness and essence. We know that oil is hidden beneath the earth and it is a natural resource that has to be uncovered to see the value. In conclusion Still I Rise, is a poem of personal perseverance and triumph, were the resilience of human strength shows that were are able to supercede through any adversaries. The main message still resonates and its relevant in our society till this day. Especially, nowadays when racism is still very much alive in many parts of our country. This poem as it title says to rise no matter what obstacles we face in life; we cannot give in, or give our power away.

How Does The Brain Perceive Essays - Auditory System, Ear, Cochlea

How Does the Brain Perceive How does a human hear? When an object makes a noise, it sends vibrations (better known as sound waves) speeding through the air. These vibrations are then funneled into your ear canal by your outer ear. As the vibrations move into your middle ear, they hit your eardrum and cause it to vibrate as well. This sets off a chain reaction of vibrations. Your eardrum, which is smaller and thinner than the nail on your pinky finger, vibrates the three smallest bones in your body: first, the hammer, then the anvil, and finally, the stirrup. The stirrup passes the vibrations into a coiled tube in the inner ear called the cochlea. The fluid-filled cochlea contains thousands of hair-like nerve endings called cilia. When the stirrup causes the fluid in the cochlea to vibrate, the cilia move. The cilia change the vibrations into messages that are sent to the brain via the auditory nerve. The auditory nerve carries messages from 25,000 receptors in your ear to your brain. Your brain then makes sense of the messages and tells you what sounds you are hearing. While you are sitting in the meadow, you might hear a calm breeze,some bees buzzing around and maybe some birds chirping. The wind rustles through grass and creates sound waves. Your ears collect these sound waves and causes your eardrum to also vibrate. The eardrum the makes your hammer, anvil, and stirrup. The stirrups vibrations move the liquid in your inner ear and the cilia translate those vibrations into something the brain can understand. The brain processes the messages and realizes that you are hearing a calm breeze. The same thing would happen if you heard a bee buzzing around, except the different sound waves that it makes would cause the ear to process a message that would tell the brain that it is hearing a bee. Likewise for the birds, unless of course its a bird you have never heard before, but we will assume you have. Since we have experienced these sensations before, its like the noise comes in, its processed and matched up to see if we have ever heard anything like it before. Its sort of like pulling open a filing cabinet and looking for something. What happens if we have never heard a sound before. Lets say while you were in the meadow and you heard some hideous shrieking noise. You think to yourself, "What's that?" You would probably have to use your other senses to establish exactly what was making the noise, but after that your mind knows what that particular sound represents. Using the filing cabinet analogy again, it would be just like adding another folder. How does our body feel? Our body feels by getting messages from receptors in our skin. But its not the same for all sensations. For touch and pressure, the skin receptors get pressed on the transmit a signal to the medulla and the thalamus, then it goes to the sensory cortex into the parietal lobe of the brain then the brain translates it into a concept that it can understand. By the characteristics in the signal the brain can tell the difference between a feather in our palm to being tackled by a lineman. If the sensation is a heat, or lack there of, is passed directly to the thalamus and then to the reticular formation. My theory on why it does that is that a change in outside temperature could change our inner- body temperature, thus unbalancing our homeostasis. But no matter whether its pressure or temperature, if the sensation is painful our body reacts completely differently. If there is an instance of pain the brain tells the body to do something to stop it, fast. While we are laying in the meadow on a mid-June day our skin senses are very busy. Since it is sunny and in June, I am assuming that it is warm if not hot. Our skin feels the suns rays burning our delicate skin. It picks up a warmer feeling than when we were in our car with the AC on. It sends a signal to the brain, via the thalamus to the reticular formation, that it warm

How to Test for Protein in Food

How to Test for Protein in Food Protein is an essential nutrient that builds muscle in the body. Its also easy to test for. Heres how: Protein Test Materials Calcium oxide (sold as quicklime in building supply stores)Red litmus paper (or another method to test pH)Â  WaterCandle, burner, or another heat sourceEye-dropperTest tubeMilk or other foods to test Procedure Because milk contains casein and other proteins, its a good food to start your testing with. Once you understand what to expect from testing milk, you can examine other foods. Add a small amount of calcium oxide and five drops of milk to a test tube.Add three drops of water.Dampen the litmus paper with water. Water has a neutral pH, so it should not change the color of the paper. If the paper does change color, start again using distilled water rather than tap water.Carefully heat the test tube over a flame. Hold the damp litmus paper over the mouth of the test tube and observe any color change.If protein is present in a food, the litmus paper will change color from red to blue. Also, smell the test tube: If protein is present, you should be able to detect the odor of ammonia. Both of these indicate a positive test for protein. If protein is not present in the test sample (or is in insufficient concentration to produce adequate ammonia during testing), the litmus paper will not turn blue, resulting in a negative test for protein. Notes About the Protein Test Calcium oxide reacts with protein to break it down into ammonia. The ammonia changes the acidity of the sample, causing a pH change. If your food is already very alkaline, you wont be able to use this test to detect protein. Test the pH of food to see if it changes the litmus paper prior to performing the protein test.Milk is an easy food to test because its a liquid. To test solids, such as meat, cheese, or vegetables, you must first grind the food by hand or by using a blender. You may need to mix the food with some water to make a sample you can test.The test registers a change in pH, which is the concentration of hydrogen ions in an aqueous or water-based solution. Most foods contain water, so they work fine for the test. However, oily foods may not work as well. You cant test pure vegetable oil, for example, because it doesnt contain any water. If you test greasy foods, such as french fries or potato chips, youll need to mash them up and mix them with a bit of water first.

Discussion Essay Example | Topics and Well Written Essays - 250 words - 61

Discussion - Essay Example Trying to match the racial and ethnic structure of the population may not be the best move as it becomes difficult for people to choose where they need to be assigned (Fried and Fottler 37). Furthermore, the medical schools present need to provide the exact number of anticipated nurses targeted to graduate. This is so as to try and fill the number of spots that retired nurses, physicians, and professionals leave after serving in the health field. This can be done through the training-output estimation program, which may bring focus to the projected number of future nurses in healthcare organizations. Predicting the estimated population may present organizations with a foreseeable number of nurses that may be needed in different areas. Ensuring that organizations are aware of these numbers may provide them with a rough estimate of how many nurses, physicians, and professionals may be needed to cater to the rising population (Fried and Fottler 32). These are some of the ways in which the shortages that are occurring nation-wide can be handled and assist in providing prospective nurses the opportunity to work and prove their worth in the health

Court system Essay Example | Topics and Well Written Essays - 500 words

Court system - Essay Example According to the article, it is even possible for Casey to be set free if Judge Belvin Perry rules that Casey could serve the years concurrently. The article also gave a brief background on the details of the trial. It also discussed the varied reactions on the verdict from the people inside and outside the courtroom. I think that the writers of the article presented the facts of the case in a fair and unbiased manner. They gave both sides of the case in an objective manner. However, there was one part of the article where I doubted their being fair, specifically in page 2. The title given to that part of the article is â€Å"Casey Anthony’s Shocking Verdict† (Hopper, Friedman and De Nies 2). I think that the word â€Å"shocking† implied that the authors expected a guilty verdict. I myself am not in agreement with the â€Å"not guilty† verdict given by the jury. I felt that there was enough evidence to convict Casey for the gruesome murder of her daughter. The question left unanswered by the article is whether an appeal could still be made by the prosecutors.

Theories of juvenile deliquency Assignment Example | Topics and Well Written Essays - 250 words

Theories of juvenile deliquency - Assignment Example In order to belong, youths have the ideology that they have to be rich and famous. Economically underprivileged adolescents may be pressured to obtain money in unlawful ways, such as stealing and the like. The thinking of the youth today must be transformed and they should be made aware that they have to be critical in choosing their peers. Another theory is that of Albert Bandura. His theory is known as the â€Å"Social Learning Theory†. Bandura points to the environment as the cause of possible criminal acts committed by the youth. He reasoned that the adolescent observes his environment and tries to imitate what he sees. In this specific theory, family, peers, and media can directly influence the behavior of the youth (Kartha, 2010). The picture on the right suggests the effect of media on today’s youth. Juveniles are usually in want of entertainment and their common sources of this are the television and the internet. Viewing shows that can either directly or indire ctly promote violence can affect the mind of the viewing minor. Without authoritative parental guidance, he might be led to thinking that what he views is acceptable by society. To reduce cases of juvenile delinquency, parents are compelled to monitor the shows and websites their children see.

Genetic Variation of Taste Receptors

Genetic Variation of Taste Receptors Abstract: The people have different behaviour to choose the food, and there are many factors that affect the food choices. The best significant factor to choose the food is taste. Differences in taste perception of several taste modalities are associated to difference in the taste receptors. Polymorphisms of the genes that encoding these taste receptors may clarify these unpredictability in taste perception. Individual changes in the capability to identify bitter tasting compounds, such as phenylthiocarbamide (PTC) was a well-known example of this variability. This difference divided the people in two groups: tasters and non-tasters, and is because of in part to single nucleotide polymorphisms (SNP) of a bitter taste receptor gene, taste receptor, type 2 (TAS2R) 38. The experiment was designed to determine the PTC phenotype and genotype, the SNP at position 785 is of particular importance in genotyping. DNA was extracted from check cell by using Chelex technique and genotyped by using polymera se chain reaction (PCR) followed by restriction fragments length polymorphism (PCR-RFLP). A 2% of Agarose gel electrophoresed and stained with Ethidium Bromide to imagine the genotype pattern. The class was tasted PTC test paper to compare phenotype and genotype. The total was 108 students the genotype showed 21 taster (+/+), 51 was mild taster (+/-) and 36 was nontaster (-/-). The allele frequency was not statistically significantly differ from European population. Therefore, TAS2R38 genotype is a truer estimation of the extent of the influence of this single gene on taste perception of PTC in a genetically diverse population. Introduction: Taste perception is the most sensitive predictor of how much a food is pleasant and unpleasant. The people are different in the taste perception of sweet, bitter, sour, or salty tastes which could influence the dietary behaviour (2, 3, 4). The variations in the taste perception between the individuals may relate to a variation in the gene taste receptors (2). The gene family of the taste receptors are encoding from TAS1R and TAS2R. The bitter taste receptors are include the TAS2R38 and TAS2R550. While the umami and sweet taste receptors is the TAS1R. The sour taste receptors are the PKDIL3 and PKD2L1. The genetic variation in these receptors may causes to deferential favourites for some types of food. Phenylthiocarbamide (PTC) compounds is the example was more studied in the variation of the sensitivity of taste as the bitterness (2, 5). The TAS2R38 gene is one of the most studied from over twenty-five in bitter taste receptor gene (4).The TAS2R38 gene is responsible for the taste perception of PTC as more bitter and the other related compounds like 6-n-propylthiouracil (PROP) which both contain a group of thiourea (7.8). The variation in the gene TAS2R38 divided the individuals in two groups of thiourea tasters: tasters and non-tasters (4, 5). Phenylthiocarbamide (PTC) The variation in the taste perception of PTC rely on the genetic studies. In 1930s, difference in the ability to taste PTC was first finding by Arthur L. Fox in a laboratory accidental (6). When he was working in the laboratory and transferring PTC powder into a bottle. Some particles of PTC powder flew into the air and his colleague close to him C. R. Noller tasted the particles as bitter but Fox tasted nothing. Fox was make experiment to test a large number of individuals and he found the difference in their ability to taste PTC and he divided the people in two main groups’ tasters and non-tasters (1). Worldwide about 25% of population classified as ‘non-tasters’ and the remaining 75% as ‘tasters’ (1). In addition, Bartoshuk et al, in 1992, discovered that the ‘tasters’ varied in the perception of PTC/PROP in a bi-modal fashion, and they separated them into medium tasters and supertasters. The supertasters were very sensitive to PTC, pe rceiving them as more bitter, while the medium tasters may taste PTC and found it mild bitter. Besides, the spread of super, medium and non-tasters in the general population is roughly 25%, 50% and 25%, respectively (1). The PTC sensitivity believed to be inherited as a simple Mendelian trait with two alleles a dominant trait (T) for taster and recessive trait (t) for non-taster (9). Figure 1: shows the inheritance of PTC trait. PTC genotype TAS2R38 or PTC gene is located on chromosome 7q and consists of a single coding exon 1002 bp long, encoding 333 amino acids, 7-transmembrane domain G-protein-coupled receptor (2, 6). A number of SNPs have been identified within this gene, the three most common SNPs (>1% of the population has variants at a specific DNA sequence, considered an SNP and (4).Also, the PAV/PAV homozygotes are sensitive to PTC more than PAV/AVI heterozygotes while AVI/AVI homozygotes are fewer sensitive (4). The AVI haplotypes in the non-tester differ at 3 SNPs from the PAV haplotypes of the tasters (9). The aim of this practical: To focus on the TAS2R38 genotype and its link with the ability to taste PTC test paper. The SNP at position 785 is of specific concern in genotyping. Comparing the allele frequency detected in the class with those observed in European population subject in group 226 and Sub-Saharan African subject in group 224. Material and Methods: To determine the TAS2R38 (A262V) genotype by using the polymerase chain reaction (PCR) and restriction endonuclease digestion, Fnu4H1 enzyme. The procedure that has been done was as the following: Protocol of DNA Extraction from Cheek Cell (scrape or wash): First week take a 10 ml of water pour into mouth and swirl to release buccal cells and spit back contents into tube. Centrifuge the tube at 3000rpm for 3 minutes, carefully pour off supernatant and retain cell pellet. Added 350Â µl of 5% Chelex mix and then transfer the pelleted buccal cells to new (1.5ml) Eppendorf tube. The 5% Chelex to protects DNA breakdown under a high temperature. Added 4Â µl of proteinase K to the Eppendorf tube that contains buccal cells and 5% Chelex. Incubated the tube containing chelex/cells at 56Â °C for 30 minutes in the heating block, then briefly vortex the tube for 10 seconds after that centrifuge the tube at 3000rpm for 20 seconds. Incubated the tube ( chelex/cells) again in heating block at 98Â °C for 15 minutes, then vortex the tube for 10 seconds, after that centrifuge for 3minutes.Transferred the supernatant that above the chelex containing the buccal cell (DNA template) into the sterile 1.5ml Eppendorf tube and measured the DNA concentration by take 1Â µl of DNA into machine called nanodrop nucleic acid then kept at -20Â °C to preserve the DNA. Protocol of Phenyl Thiocarbanate(PTC) using PCR Reaction: Second week take a 43.5Â µl of master mix was already prepared in the PCR tube and transferred 6.5Â µl of DNA extraction. (Buccal cell DNA).Vortex and spin the tube to make the liquid contents to bottom of the tube. The total PCR tube reaction volume contain 50Â µl of mixtures were placed in the PCR machine and the thermal cycler conditions were: cycle of 94Â °C for 4 minutes. The 40 cycles of 55Â °C for 40 seconds, 72Â °C for 40 seconds and 94Â °C for 40 seconds .Then 1 cycle of 55Â °C for 5 minutes and at 72Â °C for 5 minutes. The sequence of Forward primer was 5’ AACTGGCAGAATAAAGATCTCAATTTAT3’ The sequence of the Reverse primer was 5’ AACACAAACCATCACCCCTATTTT 3’. Restriction Digestion (Fnu4HI): Last week transferred a 20 ÃŽ ¼l of the component mixture (PCR product) to a tube containing 10ÃŽ ¼l of the restriction endonuclease master. The tube was placed in into a 37Â °C heating block for two hours. Electrophoresis of PCR Products: A 30ml of 2% Agarose gel with 0.5Â µl/ml of ethidium bromide was loaded into the gel tank with adjusting the comb, the gel was kept 15 minutes to get stuck. After that the TBE buffer was loaded, covering the surface of the gel and the comb was removed. Take 12Â µl of PCR product undigested and digested into two different tubes added 3Â µl of DNA loading buffer mix and spin. Then, 10ÃŽ ¼l of PCR product/loading buffer was loaded into the well of 2% Agarose gel and 10ÃŽ ¼l of the ladder (100bp) was added in the last well. The gel electrophoresed at 90 volt for 45minutes, negatively charged (-ve) DNA moved toward the anode side (red). Last take gel photograph under UV trans-illumination. Taste tests: The PTC taste test paper was used to observe the capability to identify the bitterness of PTC and its relative with the TAS2R38 genotype. Statistical analysis: The data of the allele frequency for C785 and T785 observed in the class was compared to the allele frequency of European population subjects in group 226 and Sub-Saharan African subject in group 224 by using the Chi square test. The Chi square test was also used to investigate the association between the TAS2R38 genotype and phenotype. All statistical analyses were performed with Minitab data analysis software. References Feeney E. The impact of bitter perception and genotypic variation of TAS2R38 on food choice. Nutrition Bulletin. 2011; 36(1):20-33. Wooding S, Kim U, Bamshad M, Larsen J, Jorde L, Drayna D. Natural Selection and Molecular Evolution in PTC, a Bitter-Taste Receptor Gene. The American Journal of Human Genetics. 2004; 74(4):637-646. Chaudhari N, Roper S. The cell biology of taste. The Journal of Cell Biology. 2010; 191(2):429-429. Feeney E, OBrien S, Scannell A, Markey A, Gibney E. Genetic variation in taste perception: does it have a role in healthy eating? Proc Nutr Soc. 2010; 70(01):135-143. Lalueza-Fox C, Gigli E, de la Rasilla M, Fortea J, Rosas A. Bitter taste perception in Neanderthals through the analysis of the TAS2R38 gene. Biology Letters. 2009; 5(6):809-811. Kim U, Drayna D. Genetics of individual differences in bitter taste perception: lessons from the PTC gene. Clinical Genetics. 2004; 67(4):275-280. Dotson C, Shaw H, Mitchell B, Munger S, Steinle N. Variation in the gene TAS2R38 is associated with the eating behavior disinhibition in Old Order Amish women. Appetite. 2010; 54(1):93-99. Duffy V, Davidson A, Kidd J, Kidd K, Speed W, Pakstis A et al. Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake. Alcoholism: Clinical Experimental Research. 2004; 28(11):1629-1637. Merritt R, Bierwert L, Slatko B, Weiner M, Ingram J, Sciarra K et al. Tasting Phenylthiocarbamide (PTC): A New Integrative Genetics Lab with an Old Flavor. The American Biology Teacher. 2008; 70(5):e23-e28. Appendix

Terry Tempest Williams’ Refuge Essay -- Terry Williams Refuge Essays

Terry Tempest Williams’ Refuge Adaptation is the source and story of a species’ survival. Human beings’ journey across and habitation of the earth’s surfaces demanded resilience to change. As a result each race is a product of the land in which they inhabited. We have grown with the land. Our physical traits tie us to a particular region, a particular place, but what of our emotions? Are they another link to our homelands or do they orphan us, forcing us to seek refuge? Terry Tempest Williams’ Refuge, is the story of her adaptation to change, her struggle to weather changes. The emotional maturity of her relationship with the Great Salt Lake is a subset of her wider community’s relationship to their homeland. This emotional separation from the land is characteristic of modern societies, not the archaic ones. For a Native American tribe like the Sevier-Fremont, the land is ---. In order to successful adapt to the changes in her life, Williams combines the present day idea of owner ship of the land with the Sevier-Fremont people’s example of reaction to changes in the land to form the skills necessary for her survival. In 1982 the Great Salt Lake had begun to rise once more and Williams’ mother’s cancer had returned. As naturalist-in-residence at the Utah Museum of Natural History, she was interested in the effect this rise in the lake would have on the Bear River Migratory Bird Refuge as well as the measures implemented by the state to control this unprecedented rise. The Great Salt Lake preserved many of Williams’ childhood memories in its briny waters. Its rising waters threatened to destroy everything that had grown from it and depended on its stability. Williams believed that left on its own the lake would right itself. ... ...d and selflessly relinquishes her mother to death. She comes to realize the cycles involved in life and enters a new relationship with her mother and the Great Basin. Her mother although she’s dead is always with her and the Great Basin has now become her home. In an act of civil disobedience Williams goes to protest at a testing site armed with her pen and paper. Wlliams shows her understanding of the natural cycle of death by leaving an injured bird she could have saved to be with her dying mother. Terry Tempest Williams’ Refuge is an illustration of human beings deteriorated relationship with nature. Nature is no longer our life source but something for us to own and control. Although we might recognize its life giving potential we do not see it as part of ourselves in that whether we were molded from its clay or evolved from bacteria. We grew from the earth. Terry Tempest Williams’ Refuge Essay -- Terry Williams Refuge Essays Terry Tempest Williams’ Refuge Adaptation is the source and story of a species’ survival. Human beings’ journey across and habitation of the earth’s surfaces demanded resilience to change. As a result each race is a product of the land in which they inhabited. We have grown with the land. Our physical traits tie us to a particular region, a particular place, but what of our emotions? Are they another link to our homelands or do they orphan us, forcing us to seek refuge? Terry Tempest Williams’ Refuge, is the story of her adaptation to change, her struggle to weather changes. The emotional maturity of her relationship with the Great Salt Lake is a subset of her wider community’s relationship to their homeland. This emotional separation from the land is characteristic of modern societies, not the archaic ones. For a Native American tribe like the Sevier-Fremont, the land is ---. In order to successful adapt to the changes in her life, Williams combines the present day idea of owner ship of the land with the Sevier-Fremont people’s example of reaction to changes in the land to form the skills necessary for her survival. In 1982 the Great Salt Lake had begun to rise once more and Williams’ mother’s cancer had returned. As naturalist-in-residence at the Utah Museum of Natural History, she was interested in the effect this rise in the lake would have on the Bear River Migratory Bird Refuge as well as the measures implemented by the state to control this unprecedented rise. The Great Salt Lake preserved many of Williams’ childhood memories in its briny waters. Its rising waters threatened to destroy everything that had grown from it and depended on its stability. Williams believed that left on its own the lake would right itself. ... ...d and selflessly relinquishes her mother to death. She comes to realize the cycles involved in life and enters a new relationship with her mother and the Great Basin. Her mother although she’s dead is always with her and the Great Basin has now become her home. In an act of civil disobedience Williams goes to protest at a testing site armed with her pen and paper. Wlliams shows her understanding of the natural cycle of death by leaving an injured bird she could have saved to be with her dying mother. Terry Tempest Williams’ Refuge is an illustration of human beings deteriorated relationship with nature. Nature is no longer our life source but something for us to own and control. Although we might recognize its life giving potential we do not see it as part of ourselves in that whether we were molded from its clay or evolved from bacteria. We grew from the earth.